Праймеры microRNA для qPCR

mmu-miR-335-5p праймер для qПЦР

mirBase ID: mmu-miR-335-5p
MirBase accession: MIMAT0000766
Mature sequence: UCAAGAGCAAUAACGAAAAAUGU

mmu-miR-361-5p праймер для qПЦР

mirBase ID: mmu-miR-361-5p
MirBase accession: MIMAT0000704
Mature sequence: UUAUCAGAAUCUCCAGGGGUAC

mmu-miR-185-5p праймер для qПЦР

mirBase ID: mmu-miR-185-5p
MirBase accession: MIMAT0000214
Mature sequence: UGGAGAGAAAGGCAGUUCCUGA

mmu-miR-126a-3p праймер для qПЦР

mirBase ID: mmu-miR-126a-3p
MirBase accession: MIMAT0000138
Mature sequence: UCGUACCGUGAGUAAUAAUGCG

mmu-miR-19a-3p праймер для qПЦР

mirBase ID: mmu-miR-19a-3p
MirBase accession: MIMAT0000651
Mature sequence: UGUGCAAAUCUAUGCAAAACUGA

mmu-miR-1a-3p праймер для qПЦР

mirBase ID: mmu-miR-1a-3p
MirBase accession: MIMAT0000123
Mature sequence: UGGAAUGUAAAGAAGUAUGUAU

mmu-miR-32-5p праймер для qПЦР

mirBase ID: mmu-miR-32-5p
MirBase accession: MIMAT0000654
Mature sequence: UAUUGCACAUUACUAAGUUGCA

mmu-miR-361-3p праймер для qПЦР

mirBase ID: mmu-miR-361-3p
MirBase accession: MIMAT0017075
Mature sequence: UCCCCCAGGUGUGAUUCUGAUUU

mmu-miR-182-5p праймер для qПЦР

mirBase ID: mmu-miR-182-5p
MirBase accession: MIMAT0000211
Mature sequence: UUUGGCAAUGGUAGAACUCACACU

mmu-miR-125b-5p праймер для qПЦР

mirBase ID: mmu-miR-125b-5p
MirBase accession: MIMAT0000136
Mature sequence: UCCCUGAGACCCUAACUUGUGA